Skip to main content

Table 1 Summary table of reported CASK variants

From: A de novo variant in CASK gene causing intellectual disability and brain hypoplasia: a case report and literature review

Publication No Sex Age POP LOC Variant AAC TOV Geno Phenotype
Juliane Najm et.al. (2008) [21] 1 F - - - - - - - MICPCH, ID, deafness
2 F - - - - - - - MICPCH, ID
3 F - - - - - - - MICPCH, ID
4 F - - Ex21 c.1915C > T p.(R639*) Non Hete MICPCH, ID
5 M - - Ex9 c.915G > A p. =  Spl - MICPCH, ID
Shin Hayashi, et al. (2008) [24] 6 F 5y - - arrXp11.4p11.3 (41,500,243–45,480,187) × 1 - - - MICPCH, DD, strabismus, nystagmus
Giulio Piluso et al. (2009) [3] 7 M - Ita Ex2 c.83G > T p. (R28L) Mis Hemi FG, ID, hypotonia
Patrick S Tarpey et al. (2009) [25] 8 M - - - c.829C > T p.(Y268H) Mis - ID
9 - - - Ex22 c.2129A > G p.(D710G) Mis - ID, nystagmus
10 - - - - c.2767C > T p.(W914R) Mis - ID, nystagmus
11 - - - - c.1188C > T p.(P396S) Mis - ID
Anna Hackett et al. (2010) [4] 12 M - - Ex22 c.2129A > G p.(D710G) Mis - ID, nystagmus, strabismus
13 M - - Ex27 c.2756 T > C p.(W919R) Mis - ID, nystagmus, epilepsy
14 M - - Ex8 c.802 T > C p. (Y268H) Mis - ID, epilepsy
15 M - A-A Ex13 c.1186C > T p.(P396S) Mis - ID, unsteady gait, resting tremor
16 M - - Ex23 c.2183A > G p.(Y728C) Mis - ID, cerebellar hypoplasia
17 M - - Ex26 c.2521-2A > T p.(841_868 and p.841_843 del ALK) Mis - ID, nystagmus
Ute Moog et al. (2011) [22] 18 F 10 m Fre In2 c.173-2A > C - Frs - ID, small nose, micrognathia,
19 F 10 m Fre Ex3 c.174 T > A p.(D58E) - - ID, small nose, micrognathia,
20 F 5y Bri In8 c.831 + 2 T > G - Frs - ID, epilepsy, BCH
21 F 2y
10 m
Fre In17 c.1668 + 1G > A - Spl - BCH, hypotonia, small nose
22 F 4y Ame Ex5 c.379C > T p.(E127*) - - Axial hypotonia, peripheral hypertonia,
23 F 8y Ame Ex17 c.1639C > T p.(Q547*) - - BCH, hypertonia, strabismus
24 F 2y4m Ame In5 c.430–2 A > T - Spl - BCH, hypertonia, dyskinesia
Jun-ichi Takanashi et al. (2012) [26] 25 F 7y Jap - c.173_173 + 1delGG - - - MICPCH, DD
26 F 11y Jap - c.2302 + 1 del T - - - MICPCH, DD
27 F 8y Jap - c.1910G > A p.(G637D) - - MICPCH, DD
28 M 2y Jap - c.1061 T > C p.(L348P) - - MICPCH, DD, epilepsy
29 F 24y Jap Ex4 c.316C > G p. (R106 *) - - MICPCH, DD, epilepsy
Lydie Burglen et al. (2012) [27] 30 F 7y - Ex1-8 Xp11.4 deletion 0.3 Mb - - - PCH, ID, DD, FD, spasticity
31 F 3y - Ex 1–27 Xp11.3-p11.4 deletion 3 Mb - - - ID, DD, deafness, FD, spasticity
32 F 14y - Ex1 Xp11.4 deletion 0.5 Mb - - - ID, DD, FD spasticity
33 F 13y - Ex21 c.1968G > A p.(W656*) Non - ID, DD, FD, epilepsy
34 F 3y - In21 c.2040–2 A > G - Spl - ID, DD, deafness spasticity
35 F 1y - Ex22 c.2080C > T p.(Q694*) Non - ID, DD, FD
36 F 1y - Ex22 c.2074C > T p.(Q692*) Non - ID, DD, epilepsy
37 F 10y - In24 c.2302 + 5G > A - Spl - ID, DD, deafness, epilepsy,
38 F 14y - In21 c.2039 + 1G > T - Spl - ID, DD, FD, spasticity,
39 F 8y - Ex21 c.1970G > A p.(W657*) Non - ID, DD, FD, stereotypies
40 F 3y 6 m - Ex15 c.1501dupA p.(M501fs) Frs - ID, DD, FD,
stereotypies
41 M 15y - Ex4 c.[= /316C > T] p.(R106*)mos Non - ID, DD, FD, stereotypies
42 M 13y - In3 c.278 + 1G > A - Spl - ID, DD, FD, epilepsy
Vassili Valayannopoulos,et al. (2012) [28 43 F 13y - - c.1970G > A p.(W657*) - - MICPCH, trunk ataxia, swallowing difficulties
44 F 8y - Ex16 c.1577delG p.(R526Sfs-X74) Frs - MICPCH, trunk ataxia, dystonia, spasticity
45   13y - Ex21 c.1968G > A p.(W656*) - - MICPCH, dystonia, swallowing difficulties
Hirotomo Saitsu, et al. (2012) [29] 46 M 4y - Ex2 (NG_016754.1: g.17883_129055del deletion 111 Mb - - MICPCH, OS, micropenis
47 M 4y - Ex1 c.1A > G p.(M1V) - Hemi MICPCH, OS,
Shin Hayashi et al. (2012) [5] 48 F 2y 8 m Jap Ex2 c.79C > T p.(R27*) Non - ID, DD, deafness, microcephaly, hypotonia
49 F 2y Jap - c.316C > T p.(R106*) Non - ID., deafness, microcephaly, hypotonia
50 F 2y 8 m Jap Ex27 c.2632C > T p.(Q878*) Non - ID, hyperopia microcephaly
51 F 11 m Jap Ex3 c.243_244delTA p.(Y81*) Frs - microcephaly, ID
52 F 7y
9 m
Jap In4 c.357-1G > A p.S119Rfs7X, p.H120Rfs22X Spl - microcephaly, ID
53 F 14y Jap - c.2041-1G > C p.W608Cfs29X,
p.W608Cfs3X
Spl - Microcephaly, ID
54 F 1y 9 m Jap - arrXp11.4p11.3 (41,009,876–44,100,501) × 1 - - - MICPCH, DD, deafness, hypotonia
55 F 2y Jap - arrXp11.4p11.3 (41,337,795–42,468,013) × 1 - - - MICPCH, DD
56 F 12y Jap - arrXp11.4 (41,405,593–41,570,391) × 3 - - - MICPCH, DD, epilepsy, strabismus
57 F 2 m Jap - arrXp11.4 (41,382,179–41,540,922) × 3 arrXp11.22 (56,012,908–56,275,153) × 3 - - - MICPCH, DD, epilepsy, hypotonia, strabismus
Nakamura K. et al. (2014) [23] 58 M - - Ex3 c.227_228del p.(E76Vfs*6) Frs Hemi PCH, TOF, epilepsy
JacquesL. Michaud et al. (2014) [30] 59 F 36 m - Ex2 c.82C > T p.(R28*) - - ID, cortical and cerebellar atrophy
Ute Moog et al. (2015) [31] 60 M 7 m - Ex7 c.704_708del p.(K236Efs* 10ex7dn) Frs - MICPCH, ID, DD, epilepsy, hypotonia
61 M 10 m - - dup ex10 – 16dn - - - MICPCH, ID, DD, epilepsy, hypotonia
62 M 5y - - c.1A > G ex1dn - - - MICPCH, ID, DD, epilepsy, hypotonia
63 M 15 m - - c.79C > T p.(R27*ex2 dn) - - MICPCH, ID, DD, epilepsy, hypotonia
64 M 7 m - - dup ex4–20 mos - - - MICPCH, ID, DD, epilepsy, hypertonia
65 M 16 m - - del ex1mos - - - MICPCH, ID, DD, hypertonia
66 M 29 m - - del ex3–9 mos - - - MICPCH, ID, DD
67 M 20 m - - dup ex1–5 mat - - - Microcephaly, DD
Tomoshi Nakajiri et al. (2015) [32] 68 F 13y Jap Ex21 c.1896dupC p.(C633Lfs*2) Frs Hete MICPCH, epilepsy
Patrick Rump et al. (2016) [33] 69 F 22y - - c.2302 + 2 T > G - - Hete MICPCH, ID, DD, FD, epilepsy
Lucía Rivas et al. (2017) [34] 70 F 5y - - deletion254.01 Kb - - - MICPCH, WS
Shin Hayashi et al. (2017) [35] 71 F 1y - - c.868G > T p.(E290*) - - MICPCH, DD
72 F 5 m - - c.761-762delCT p.(S246*) - - MICPCH, hypotonia
73 F 15y - - c.1006-1012del ACCTCCT p.(T336Qfs* 23) - - MICPCH, epilepsy, DD, hypotonia
74 F 4y2m - - c.2103delT p.(F710Lfs* 26) - - MICPCH, DD
75 F 1y - - c.1677dupG p.(R560Afs* 20) - - MICPCH, DD
76 F 17y - - c.2508delT p.(L837*) - - MICPCH, DD, epilepsy
77 F 11y - - c.1896dupC p.(C633Lfs*2) - - MICPCH, epilepsy DD, hypertonia
78 F 1y - - c.1582 + G > A - - - MICPCH, DD
79 F 3y - - c.2302 + 1G > T - - - MICPCH
80 M 4y 4 m - - c.317G > C p.(R106P) - - MICPCH
81 M 2y - - c.[= /1493_1503 + 10delATGAACCAATGGTAAGTAGGAinsGG] p.(D498Gfs* 12) - - MICPCH, epilepsy DD, hypotonia
82 F 6y4m - - arrXp11.4p11.3 (41,618,898–43,755,475) × 1 - - - MICPCH, DD, epilepsy
83 F 4y - - arrXp11.4p11.3 (41,145,925–46,090,321) × 1 - - - MICPCH,
84 F 12y8m - - arrXp11.4p11.3 (41,163,139–44,592,980) × 1 - - - MICPCH, DD, glaucoma, PHPV
85 F - - - arrXp11.4 (41,442,660–41,527,850) × 3 - - - Died
Bernt Popp et al. (2017) [36] 86 F 5y Ger Ex2 c.68del p.(F23Sfs*18) Frs - MICPCH, deafness, ID hypertonia
Stephanie C. DeLuca et al. (2017) [37] 87 F 54 m - - c.2221 + 1G > C - - - MICPCH, single- word speech
88 F 89 m - Ex17 c.1609C > T p.(R537*) - - MICPCH
89 F 24 m - - c.106C > T p.(Q36*) - - MICPCH, DD
P. Dunn, et al. (2017) [38] 90 M 6y 6 m - Ex26 c.2521–2 A > G - - - FG, nystagmus
Toshiyuki Seto et al. (2017) [39] 91 M 5y - Ex15 c.1424G > T p.(S475I) Mis - microcephaly, ASD
92 F 3y - - c.1424G > T p.(S475I) Mis - DD, ASD
Babylakshmi Muthusamy et al. (2017) [40] 93 M 14y & 17y Ind - E550_dup Stop gain and in-frame insertion - Hemi microcephaly, clinodactyly
Xiuhua Bozarth et al. (2018) [41] 94 F - ME-C - c.2179–2181del GTA p.(V727del) - Hete infantile spasms, nystagmus, strabismus
Leslie E. W. LaConte et al.(2018) [42] 95 F 12y - - c.1556 T > C p.(M519T), Mis - MICPCH, gait ataxia, nystagmus
96 F 5y - - c.1989G > A: p.(G659D) Mis Hete MICPCH strabismus
97 F 9y - - c.626 T > C p.(L209P) - - MICPCH, ID, motor disability
Hiroaki Murakami et al. (2019) [43] 98 F 5y - - c.2041C > T p.(R681*) Non - microcephaly, BCH, DD, hypotonia
Francesca Cristofoli et al. (2019) [44] 99 F 25y Eur - c.1315–7 A > G p.(M438-A 439 insH*) Spl - ID, DD, dystonia, small cerebellum
100 F 21y Eur - c.C109T p.(Q37*) Non - ID, DD, visual impairment
101 F 6y Eur - c.T626C p.(L209P) Nonsy-nonym-ous - ID, DD, FD, hypotonia, nystagmus
102 F 17y Eur - c.2302 + 1 G > A p.(G741-H768 delinsD) Spl - ID, DD, Visual impairment
ZHANG Yi, et al. (2019) [7] 103 M 3 m 27d Chi Ex20 c.1818_1821dup AACT p.(T608Nfs* 16) Frs Hemi MICPCH, DD, FD, hypertonia
This study 104 M 18d Chi Ex8 c.764G > A p.(R255H) Mis Hemi microcephaly, ID, DD, epilepsy, deafness
  1. Abbreviations: POP Population, LOC Location, AAC Amino acid change, TOV Type of variant, Geno Genotype, F Female, M Male, Ita Italian, A-A African-American, Fre French, Bri British, Ame American, Jap Japanese, Ger German, Ind Indian, MEC Mixed-European Caucasian, Eur European, Chi Chinese, Ex Exon, In Intron, Non Nonsense, Spl Splicing, Mis Missense, Frs Frameshift, Hete Heterozygous, Hemi Hemizygote, MICPCH Microcephaly with pontine and cerebellar hypoplasia, ID Intellectual disability, DD Developmental delay, FG FG syndrome, BCH Brain stem and cerebellar hypoplasia, PCH Pontine and cerebellar hypoplasia, FD Feeding difficulties, OS Ohtahara syndrome, TOF Tetralogy of Fallot, WS West syndrome, PHPV Persistent hyperplasia of primary vitreous, ASD Autism spectrum disorder