Skip to main content

Table 1 Forward and reverse primers used for real-time PCR

From: Investigation of the relationship between community-acquired respiratory distress syndrome toxin and the high-mobility group box protein 1-toll-like receptors-myeloid differentiation factor 88 signaling pathway in Mycoplasma pneumoniae pneumonia

DNA F(5’ → 3’) R (5’ → 3’)
pdh A ACTGGTTCTGCCCTACCTTCCGTTCC CTTCGTGCATTGCTTCGTAACTCGC
18 s ACGACCCATTCGAACGTCTG CCGTTTCTCAGGCTCCCTC
CARDS TX TTCCACTTCAGAAACACCCACAGC TCAATCAGGGCACGCAAACG
HMGB1 TGTAAGGCTGTGTAAGATT AAGGTTAGTGGCTATTGAA
RAGE GTGAAGGAACAGACCAGGAGAACA TGGGCTGAAGCTACAGGAGAA
TLR2 TGAGGAACTTGAGATTGAT CACGGAACTTGTAACATC
TLR4 TCAGTGTGCTTGTAGTAT CCTGGCTTGAGTAGATAA
MyD88 AGCCATTCACACATCTTCACCC GCTATGCTTCACCATTTCCTACA
TLR6 TGCAGAGTAACAGGAGCACACA ACCCTCGGACTCCAGCAAA
CD14 CTCAGCTGCAACAGACTGAACA GGAGTTCATTGAGCCCTCGTG