Skip to main content

Table 1 Natural or mutagenesis primers, restriction enzymes, and SLCO1B1 genes and variations

From: Polymorphic variants of SLCO1B1 in neonatal hyperbilirubinemia in China

Positions (cDNA) Primers Sequences Restriction enzymes Results (bp)
388 388 F 5′ATAATGGTGCAAATAAAGGGG3′ Taq I G 128 + 63 + 23
G → A 388R 5′ACTATCTCAGGTGATGCTCTA3′   A 151 + 63
521 521 F 5′TTGTCAAAGTTTGCAAAGTG3′ Hha I T 209
T → C 521R 5′GAAGCATATTACCCATGAGC3′   C 189 + 20
463 463 F 5′ATAATGGTGCAAATAAAGGGG3′ Hpa II C 205 + 19
C → A 463R 5′ACCTTTTCCCACTATCTCCG3′   A 224