Skip to main content

Table 1 Primer sequences, PCR product size, restriction enzymes and band sizes of SNPs selected for this study

From: Study of variants associated with ventricular septal defects (VSDs) highlights the unique genetic structure of the Pakistani population

SNPs Gene Primer sequence PCR product size Restriction Enzyme Restriction Fragment Size
rs1017
NG_023040.1:g.16138A > T
ISL1 F-CTCTTGGCCTGTCCTGTAGC
R-GCAATGCAAGAGCAAACAAA
318 bp DraI AT: 201, 117,95 and 22 bp
AA: 201 and 117 bp
TT:201, 95 and 22 bp
NC_000006.10:g.126117350A > C
Asp98Ala (293A > C)
HEY2 F-GCCACAAGTACCCAGAAGAAAC
R-GCACAAGTCTTCTCAACTCAG
340 bp MboI 296 bp
44 bp
rs36208048 NG_008732.1:g.3877C > A VEGF F-AACCCCCATTTCTATTCAG
R-CTGTGGAGTCTGGCAAAA
278 bp AlwN1 Wild type
cut at C
146 bp
132 bp
rs7240256
NG_029226.1:g.23449 T > C
NFATc1 FI- GGTCACATGCAGCAGCGCT
RI- TGACATTTTCCACGCCTGACG
FO-GGTTTGCAGTTAACCTTTTCCCA
RO-AGAAAGCTCCTTCTGGCATAGG
––– ––– 196 bp (T allele wild type)
239 bp (C allele SNP)
384 bp outer primers
rs11067075 NG_007373.1:g.51682G > T TBX5 FI- GTGATAAGGAATCAGCCGGGT
RI- GAATCCCAACTGGAAGGAGAC
FO- TCCTGCCTAGGAGACAACAAATA
RO-AGACAATGAGGGGAAGTCAGATA
––– ––– 124 bp T allele
99 bp (wild type, G allele)
171 bp outer primers
rs1801133
NG_013351.1:g.14783C > T
MTHFR OF-GCTGTTGGAAGGTGCAAGATCA
OR-GAGTGGGGTGGAGGGAGCTTAT
IF-AGAAGGTGTCTGCGGG
IR-AAAGCTGCGTGATGAAAT
––– ––– 177 bp for T allele
230 for C allele
366 bp outer primer