Skip to main content
Download PDF

Polymorphisms of the sodium voltage-gated channel, alpha subunit 1 (SCN1A -A3184G) gene among children with non-lesional epilepsy: a case-control study

Italian Journal of Pediatrics volume 48, Article number: 157 (2022) Cite this article

Abstract

Background

Mutations in the neuronal sodium voltage-gated channel, alpha subunit 1 (SCN1A) gene have been associated with epilepsy. We investigated the SCN1A-A3184G polymorphism among Egyptian children and adolescents with non-lesional epilepsy.

Methods

A prospective case – control observational study was done in Mansoura University Children’s Hospital, Egypt including 326 children with non-lesional epilepsy (163 antiepileptic drugs (AEDs) resistant cases & 163 AEDs responders) and 163 healthy controls. One step real time polymerase chain reaction (PCR) was used for the molecular analysis. Student’s t-test, and Monto Carlo, chi-square and Mann–Whitney tests were used for the statistical analysis.

Results

All study participants were matched as regards the age, sex and body weight (p = 0.07, 0.347 and 0.462, respectively). They had the (AA) and (AG) genotypes but not the (GG) variant. No significant differences were found between cases and controls regarding (AG) and (AA) genotypes and A- and G-alleles (p = 0.09 and 0.3, respectively). We did not find significant differences between AEDs responders and resistant cases regarding the studied genotypes and alleles (p = 0.61 and 0.746, respectively). In the resistant group, we observed significant associations between the (AG) genotype and seizure frequency (p = 0.05), the tonic-clonic seizure (p < 0.001), the younger age of first seizure attack (p = 0.03), abnormal electroencephalogram (EEG) (p < 0.001), the positive family history of epilepsy (p = 0.006), topiramate (p = 0.03) and valproic acid (p < 0.001), while the (AA) genotype was associated with carbamazepine (p = 0.03). While in AEDs responders, there were significant associations between the AG genotype and the abnormal EEG activity, levetiracetam and carbamazepine (p = 0.016, 0.028 and 0.02).

Conclusions

The SCN1A-A3184G genotypes and alleles were not associated with the epilepsy risk among Egyptian children. Significant associations were reported between the AG genotype and some predictors of refractory epilepsy.

Background

Epilepsy is a multifactorial channelopathy disease with the involvement of both acquired and genetic factors [1]. Knowing the exact etiology of epilepsy is crucial for patients’ treatment and for neurobiological researchs that could direct future personalized therapies [2]. Neuronal voltage-gated sodium channels (SCN) are proteins responsible for the generation and propagation of the action potentials within the neurons. This occurs through affection of the membrane permeability to sodium ions and facilitation of the ions diffusion down an electrochemical gradient till the sodium equilibrium potential [3].

There are evidences about the role of the SCN polymorphisms in the epilepsy pathogenesis. These polymorphisms have been associated with a spectrum of epilepsy syndromes such as generalized epilepsy with febrile seizures plus, borderline severe myoclonic epilepsy of infancy, Dravet syndrome, Doose syndrome and infantile spasms [4, 5]. Most of SCN mutations are within SCN1A gene and fewer are within the SCN2A, SCN8A and SCN1B genes [6]. The SCN1A gene is located in the chromosome 2 (2q24.3) and includes 26 exons. SCN1A encodes the alpha subunit of the sodium channel NaV1.1 [7]. This type of channels conduct sodium ions through pores in the cellular membranes. Its architecture comprises four domains with six segments; four homologous domains (D1–D4), each containing six α-helical segments (S1–S6). The positively charged residues in the S4 segment or voltage-sensing helix of each domain are involved in the the graded membrane potential changes and generation of the action potentials [8].

Several studies have reported the efficacy of the sodium-channel blockers for the treatment of epilepsies due to genetic channelopathies. Carbamazepine, oxcarbazepine, phenytoin, lamotrigine, lacosamide and lidocaine prevent seizure activity through blocking the movement of sodium ions across sodium ion channels during the propagation of action potentials. This group of antiepileptic drugs (AEDs) has an additional advantage through acting on potassium channels, due to structural similarities, thus controlling genetic epilepsies due to mutations of voltage-gated potassium channel genes [9].

The SCN1A-A3184G (p.Thr1067Ala) polymorphism has been suggested to be involved in the gating of sodium channels, thus rendering them insensitive to sodium-channel blockers [10, 11]. The association of the SCN1A-A3184G polymorphism with the epilepsy risk was investigated in several non-Caucasian populations [12,13,14,15] and in a limited number of Caucasian populations [10, 16] with inconsistent results, thus necessitating additional studies.

Some studies reported significant associations between the SCN1A polymorphisms and AEDs resistance [8]. Others tried to investigate the possible associations between these polymorphisms and AEDs choice and doses. Tate et al. reported a significant association between the SCN1A polymorphism and the dose of phenytoin and carbamazepine, and suggested a trend of reduction in the maximum dose required according to the genotype [17]. Heinzen et al. noted that individuals with the AA genotype of the rs3812718 variant need higher doses of AEDs than others with the GG genotype [18].

In the current research, we investigated the patterns and frequencies of SCN1A-A3184G (p.Thr1067Ala) polymorphism among Egyptian children and adolescents with non-lesional epilepsy, including both AEDs responders and resistant cases. We tested the association between SCN1A-A3184G genotypes and some predictors of refractory epilepsy. We also highlighted the possible pharmacological implication of studying the target polymorphism, through describing the frequently used AEDs and their possible link with the genotypes.

Methods

Study design and participants

We conducted a preliminary prospective case – control study in Mansoura University Childrens’s Hospital, Mansoura, Egypt from February 2020 to January 2022. We enrolled 326 children with non-lesional epilepsy; 163 AEDs resistant patients and 163 AEDs responders. We included 163 healthy children of comparable genders and ages as a control group. We recruited the controls from the same hospital while they attended for regular follow-up visits or for minor complaints such as pharyngitis and mild gastroenteritis. All controls had no history of neurological disorders, and were of the same ethnic origin as the patients.

Non-lesional epilepsy was described if there was a history of at least two unprovoked seizures accompanied by epileptiform electroencephalogram (EEG) changes in a patient with normal neurological examination and development, and no structural lesions detectable by magnetic resonance imaging [19]. AEDs resistance was defined if at least four seizure attacks happened over 1 year after using the maximum tolerated doses of three appropriate AEDs [20, 21]. Recovery from fits for at least 1 year after starting AEDs was the hallmark for considering the child as an AEDs responder [20, 22]. Patients with a single episode of seizure, metabolic derangement, secondary epilepsies and poor compliance to therapy were excluded.

Clinical data collection

We retrieved relevant data of the patients from archive files including their gender, age, the seizure type and frequency, the age of onset of seizures, the duration since the last seizure attack (in months), EEG findings and AEDs therapies. We assessed all patients for the seizure type (tonic, tonic-clonic, clonic, myoclonic and absence) using the 2017 International League Against Epilepsy (ILAE) operational classification [19].

Molecular analysis of the SCN1A (rs2298771) polymorphism

We extracted genomic DNA from the whole venous blood using QIAamp DNA blood mini kits (provided by QIAGEN, USA, Catalog Number: 51104) and stored at − 20 °C till used. We measured the genomic DNA purity and concentration, from the controls and cases, using the NanoDrop™ 2000 Spectrophotometer (Thermo Scientific, Waltham, MA).

The genotyping of the SCN1A (rs2298771) polymorphism was carried out by the TaqMan single nucleotide polymorphism (SNP) Genotyping Assays (Applied Biosystem, Foster City, CA). The PCR primers and the variant type allele-specific TaqMan MGB probes were designed by Applied Biosystem. The SNP ID was C 11748767_20 for the SCN1A (rs2298771) polymorphism; and the chromosomal location was Chr.2:166036278.

The context sequence [VIC / FAM] was: TAGTCAAGATCTTTCCCAATTTCTG[C/T]TGTATGATTGGACATACAACTGTCT.

As a reporter at the 50 end of TaqMan MGB probe, VIC and FAM were used for the A-allele (Allele-1) and the G-allele (Allele-2), respectively.

We prepared 25 μL of the PCR reaction mix for qPCR analysis as follow: 7.25 μL DNase-free and RNase-free water, 12.5 μL TaqMan universal master mix II with UNG 2× (# 4440042, Applied Biosystem), 4 μL DNA template and 1.25 μL TaqMan assay 20×. We transferred PCR reaction mix to the 48-well reaction plate that was sealed using an appropriate cover. Then, centrifugation was done, and followed by loading into the step one real-time PCR (Applied Biosystem). The cycling stages of the reaction were as follow: stage I for UNG incubation for 30 s at 60 °C, stage II for polymerase activation for 10 min at 95 °C, stage III for PCR and included 40 cycles of denaturation at 95 °C for 15 s, annealing/extension at 60 °C for 60 s and finally stage IV for 30 s at 60 °C. We discriminated the alleles by asessing the fluorescence intensity at the endpoint.

We analyzed the results of the measurements using the SDS software version 1.7 (Applied Biosystem), and detected the genotypes (Figs. 1 and 2). We randomly assayed 10% of the original specimens for replicate to exclude errors of genotyping. We did not detect discrepancies between the genotypes which were determined in duplicate.

Fig. 1
figure 1

Real time PCR Amplification plots of the genomic DNA of four cases with the AG genotype of the SCN1A-A3184G polymorphism (Allele 1 = A-allele, Allele 2 = G-allele)

Full size image
Fig. 2
figure 2

Real time PCR Amplification plots of the genomic DNA of four cases with the AA genotype of the SCN1A-A3184G polymorphism (Allele 1 = A-allele, Allele 2 = G-allele)

Full size image

Statistical analysis

We analyzed data using the Statistical Package for the Social Sciences (SPSS) Version 25 (IBM Corp, Armonk, NY). Numbers (percent) were compared by Monto Carlo and chi-square tests (χ2). Parametric data (mean ± SD) were analyzed by the Student’s t-test while non-parametric data (median and interquartile range) were analyzed by the Mann–Whitney test. P values ≤0.05 were considered statistically significant. Genotypes and allelic frequencies of SCN1A (rs2298771) polymorphism were tested using the chi-square test to verify the agreement with Hardy–Weinberg equilibrium (p > 0.05 for each group).

Results

Descriptive data and characteristics of the study participants

Both AEDs resistant and AEDs responders groups were matched with the control group as regards the age, gender and body weight (p = 0.07, 0.347 and 0.462, respectively, Table 1). AEDs-resistant group showed higher seizers frequency, shorter time intervals since the last seizure attack and more abnormal EEG findings (p < 0.001, Table 2). No statistically significant differences existed between AEDs responders and resistant groups regarding the age of the first seizure attack (p = 0.642, Table 2). Regarding the type of seizures, the most frequent type of seizures in both groups was the tonic-clonic type that was detected in 63.8 and 76.1% in the AEDs responders and AEDs resistant groups, respectively. The other common types in the AEDs responder group were the tonic seizures (20.9%) and absence seizures (9.2%) while in the AED resistant group, absence seizures were detected in 10.4% and myoclonic seizures in 7.4% (Table 2).

Table 1 Characteristics of the study participants
Full size table
Table 2 Seizure characters and antiepileptic therapies among cases with epilepsy
Full size table

The pattern of antiepileptic drugs among the patients

In the current study, valproic acid was the most frequently used AEDs in all groups (82.2% of the AEDs responder group and 90.2% of the AEDs resistant group) followed by levetiracetam in the AEDs resistant group (41.7%) and carbamazepine in the AEDs responder group (27%). There was a statistically significant difference between the both groups regarding the use of AEDs. Carbamazepine was more frequently used in the AEDs responder group (p = 0.03), while levetiracetam was more frequently used in the AEDs resistant group (p = 0.003). Topiramate was only used in the AEDs resistant group (Table 2).

The distribution of SCN1A-A3184G genotypes and alleles among the study groups

The AG genotype of SCN1A-A3184G polymorphism was the predominant genotype in all groups (81.6, 76.1 and 73.6% for the control group, the AEDs responder group, and the AEDs resistant group, respectively, Table 3). No (GG) genotype was described in the studied populations. No significant differences existed between cases and controls regarding (AG) and (AA) genotypes and A- and G-alleles (p = 0.09 and 0.3, respectively).

Table 3 Distribution of the SCN1A-A3184G genotypes and alleles among the study groups
Full size table

We did not find significant differences between AEDs responders, AEDs resistant groups and the control group regarding the genotypes and alleles of the SCN1A-A3184G polymorphism (p = 0.214 for the genotypes and 0.563 for the alleles, Table 3). Moreover, we did not find significant differences between AEDs responders and resistant cases regarding the target genotypes and alleles (p = 0.61 and 0.746, respectively, Table 3).

Associations between SCN1A-A3184G genotypes and characteristics of the patients

Regarding combined AEDs responders and resistant cases, Table 4 shows a higher seizure frequency and more generalized epileptiform EEG activity in the AG-genotyped cases (p = 0.004 and < 0.001, respectively). The frequent seizure types associating the AG genotype were tonic-clonic, tonic and absence seizures, while in patients with the AA genotype were tonic-clonic and tonic seizures. No significant differences existed between the AG and AA genotypes regarding AEDs, except for topiramate that was only used in cases with the AG genotype.

Table 4 Associations between the SCN1A-A3184G genotypes and characteristics of the patients
Full size table

In the AEDs resistant cases, there were significant associations between the AG genotype and the earlier age of onset, the seizures frequency, the abnormal EEG activity, the positive family history of epilepsy, topiramate and valproic acid (p = 0.03, 0.05, < 0.001, 0.006, 0.03 and < 0.001 respectively, Table 4). While in AEDs responders, there were significant associations between the AG genotype and the abnormal EEG activity, levetiracetam and carbamazepine (p = 0.016, 0.028 and 0.02, respectively, Table 4).

Discussion

Epilepsy is a highly heterogeneous disease with a confirmed genetic background [23, 24]. More than one quarter of the epilepsy-related genes encode ion channel proteins, including the ligand-gated ion channels (such as gamma-aminobutyric acid receptors, N-methyl-D-aspartate receptors and nicotinic acetylcholine receptors) and the voltage-gated channels (such as Ca2+, K+ and Na+ channels) [25]. The first SCN1A mutation was found in epilepsy patients by 2000 [23], but now many new SCN1A mutations have been identified making it the most common epilepsy-related gene [26]. In our preliminary research, we investigated the patterns and frequencies of SCN1A-A3184G alleles and genotypes among Egyptian children and adolescents with non-lesional epilepsy. We found that the AG genotype and the A allele are the predominant models among the study participants.

In the current study, we reported insignificant differences between epilepsy cases and the control group regarding the SCN1A-A3184G genotypes and alleles. No significant differences existed between AEDs responders and resistant cases regarding these genotypes and alleles. Lack of significant differences among our Egyptian patients could be explained on the basis of the ethnic variation. This was evidenced by Baum et al. in their large multi-ethnic study, where they considered the SCN1A-A3184G (rs2298771) polymorphism as the significant ethnic-related locus among symptomatic epilepsy patients (p < 0.001) while the frequencies of the other studied SCN1A loci (rs10188577 and rs3812718) did not differ according to the ethnicity [15]. However, the relatively small sample size could be a limiting factor in interpreting our results.

Our results also agree with Chou et al. who reported insignificant differences between 83 control subjects and 104 Taiwanese epileptic children regarding SCN1A-A3184G genotypes and alleles [14]. We also agree with Kang et al. who investigated 311 children for SCN1A-A3184G (rs2298771) and SCN2A-G56A (rs17183814) polymorphisms and tested their association with refractory seizures. They reported insignificant differences between controls and cases as regards the SCN1A-A3184G polymorphism, but the A allele of SCN2A-G56A polymorphism was associated with the refractory seizures [27]. Moreover, similar findings were described in a German study where SCN1A-A3184G polymorphism was not considered as a major contributor to the idiopathic generalized epilepsy [28]. We also agree with Hosseini et al. who evaluated the frequency of the SCN1A (rs2298771 & 7,601,520) and the ABCB1 (rs1045642) polymorphisms within the Iranian population with idiopathic refractory epilepsy. They enrolled 81 healthy subjects and 34 patients with idiopathic refractory epilepsy, and reported insignificant differences between the studied groups [29]. There is also agreement with another Chinese study including 471 patients with epilepsy (272 AEDs responders and 199 AEDs resistant cases). Authors studied the association of the responsiveness to AEDs with SCN1A, SCN2A, and SCN3A polymorphisms, and correlated any association with the mRNA expression of the neuronal sodium channels. They suggested an association between SCN2A IVS7-32A > G and the AEDs response, without any evidence of an effect on the mRNA expression or splicing. However, they reported a negative association between the SCN1A-A3184G polymorphism and the resistance to AEDs [30].

On the other hand, Lakhan et al. suggested that the AG genotype of the SCN1A-A3184G polymorphism was more frequent among North Indian epilepsy patients [p = 0.005; 95% confidence interval = 1.19–2.61, odds ratio = 1.76] [12]. In a meta-analysis study done by Li et al., the SCN1A-A3184G (rs2298771) polymorphism was significantly associated with the response to AEDs [31].

In the current study, we did not find the GG genotype of the SCN1A-A3184G polymorphism among the studied population. This is in contrast to a Slovenian study where the G allele was associated with a lower epilepsy risk and a high remission rate among patients with epilepsy [7]. These discrepancies could be mainly explained by the interethnic differences in the SCN1A alleles/genotypes distribution [20].

Interestingly, the current study suggested significant associations between the heterozygous AG genotype in the epilepsy cases with the higher seizure frequency and generalized epileptiform EEG activity. Possible associations were also suggested between the AG-genotyped patients with refractory epilepsy and the earlier age of onset of seizures and duration since the last seizure attack. On reviewing literature, no previous reports tested the associations between the SCN1A-A3184G (rs2298771) polymorphism and the predictors of refractory epilepsy. We would like to emphasize that the higher seizure frequency, generalized epileptiform EEG activity and the earlier age of onset of seizures were proved to be significant predictors of the AEDs response in previous studies [32, 33]. This observation could open the gate for considering the AG genotype of the SCN1A-A3184G polymorphism as a predictor for treatment response, and aid in designing the personalized medicine for epileptic children according to their genotype [34]. However, large scale multi-center studies are still needed to prove such associations.

Several studies were carried out to select the most appropriate AEDs in different types of epilepsy [9, 35]. The current study suggested that levetiracetam and carbamazepine were more frequently used in the AG-genotyped responders than those with the AA genotype. Regarding the AEDs resistant group, topiramate and valproic acid were more frequently used in children with the AG genotype while carbamazepine was more frequently used in the AA genotype. This observation highlights the possible role of the SCN1A-A3184G genotypes in the selection of the appropriate AEDs.

On reviewing literature, several studies were carried out to detect the possible pharmacological implications of the SCN1A-A3184G polymorphism in epilepsy management. A recent meta-analysis including eight studies reported that Asian patients with epilepsy and the GG genotype of the SCN1A-A3184G polymorphism are at a higher risk of carbamazepine resistance [36]. On the other hand, another meta-analysis including 18 studies (2546 patients) reported no association between the same polymorphism and the carbamazepine resistance [37]. Regarding the valproic acid, a Chinese study suggested that SCN1A-A3184G polymorphism has no effect on the drug response [38]. Actually, gathering data from different ethnic groups expand the knowledge about the genetic background of epilepsy and help in personalized medicine strategy.

Study limitations

A single center study, the lack of serum AEDs levels assay and limited studied variables.

Conclusions

No significant differences were found between Egyptian children and adolescents with non-lesional epilepsy and healthy controls regarding the frequency of SCN1A-A3184G polymorphism. We suggested significant associations between the AG genotype of the SCN1A-A3184G polymorphism and some predictors of refractory epilepsy. The SCN1A-A3184G genotypes might affect AEDs selection. Multicenter large-scale studies are still needed to validate our findings.

Availability of data and materials

The datasets generated during the current study are available in the Mendeley Data: https://doi.org/10.17632/mkjprydvst.1

Abbreviations

AEDs:

Antiepileptic Drugs

EEG:

Electroencephalogram

PCR:

Polymerase Chain Reaction

SCN:

Sodium Channels

SCN1A:

Sodium Channel, Alpha Subunit 1

SNP:

Single Nucleotide Polymorphism

SPSS:

Statistical Package for the Social Sciences

References

  1. Helbig I. Genetic causes of generalized epilepsies. Semin Neurol. 2015;35(3):288–92.

    Article  Google Scholar 

  2. Thomas RH, Berkovic SF. The hidden genetics of epilepsy—a clinically important new paradigm. Nat Rev Neurol. 2014;10(5):283–92.

    Article  Google Scholar 

  3. Hille B. Ion channels of excitable membranes. 3rd ed. Sinauer: Sunderland; 2001.

    Google Scholar 

  4. Harkin LA, McMahon JM, Iona X, Dibbens L, Pelekanos JT, Zuberi SM, et al. The spectrum of SCN1A-related infantile epileptic encephalopathies. Brain. 2007;130(Pt 3):843–52.

    Article  Google Scholar 

  5. Usluer S, Salar S, Arslan M, Yiş U, Kara B, Tektürk P, et al. SCN1A gene sequencing in 46 Turkish epilepsy patients disclosed 12 novel mutations. Seizure. 2016;39:34–43.

    Article  Google Scholar 

  6. Kaplan DI, Isom LL, Petrou S. Role of sodium channels in epilepsy. Cold Spring Harb Perspect Med. 2016;6(6):a022814.

    Article  Google Scholar 

  7. Bertok S, Dolžan V, Goričar K, Podkrajšek KT, Battelino T, Rener-Primec Z. The association of SCN1A p.Thr1067Ala polymorphism with epilepsy risk and the response to antiepileptic drugs in Slovenian children and adolescents with epilepsy. Seizure. 2017;51:9–13.

    Article  Google Scholar 

  8. Catterall WA. Ion channel voltage sensors: structure, function, and pathophysiology. Neuron. 2010;67(6):915–28.

    Article  CAS  Google Scholar 

  9. Falsaperla R, Scalia B, Giugno A, Pavone P, Motta M, Caccamo M, et al. Treating the symptom or treating the disease in neonatal seizures: a systematic review of the literature. Ital J Pediatr. 2021;47(1):85.

    Article  Google Scholar 

  10. Abo El Fotoh WM, Abd El Naby SA, Habib MS, ALrefai AA, Kasemy ZA. The potential implication of SCN1A and CYP3A5 genetic variants on antiepileptic drug resistance among Egyptian epileptic children. Seizure. 2016;41:75–80.

    Article  Google Scholar 

  11. Wang P, Zhou Q, Sheng Y, Tang B, Liu Z, Zhou B. Association between two functional SNPs of SCN1A gene and efficacy of carbamazepine monotherapy for focal seizures in Chinese Han epileptic patients. Zhong Nan Da Xue Xue Bao Yi Xue Ban. 2014;39(5):433–41.

    CAS  PubMed  Google Scholar 

  12. Lakhan R, Kumari R, Misra UK, Kalita J, Pradhan S, Mittal B. Differential role of sodium channels SCN1A and SCN2A gene polymorphisms with epilepsy and multiple drug resistance in the north Indian population. Br J Clin Pharmacol. 2009;68(2):214–20.

    Article  CAS  Google Scholar 

  13. Ebrahimi A, Houshmand M, Tonekaboni SH, Fallah Mahboob Passand MS, Zainali S, Moghadasi M. Two novel mutations in SCN1A gene in Iranian patients with epilepsy. Arch Med Res. 2010;41(3):207–14.

    Article  CAS  Google Scholar 

  14. Chou IC, Peng CT, Tsai FJ, Huang CC, Shi YR, Tsai CH. The lack of association between febrile convulsions and polymorphisms in SCN1A. Epilepsy Res. 2003;54(1):53–7.

    Article  CAS  Google Scholar 

  15. Baum L, Haerian BS, Ng HK, Wong VC, Ng PW, Lui CH, et al. Case–control association study of polymorphisms in the voltage-gated sodium channel genes SCN1A, SCN2A, SCN3A, SCN1B, and SCN2B and epilepsy. Hum Genet. 2014;133(5):651–9.

    Article  CAS  Google Scholar 

  16. Daci A, Beretta G, Vllasaliu D, Shala A, Govori V, Norata GD, et al. Polymorphic variants of SCN1A and EPHX1 influence plasma carbamazepine concentration, metabolism and pharmacoresistance in a population of Kosovar Albanian epileptic patients. PLoS One. 2015;10(11):e0142408.

    Article  Google Scholar 

  17. Tate SK, Depondt C, Sisodiya SM, Cavalleri GL, Schorge S, Soranzo N, et al. Genetic predictors of the maximum doses patients receive during clinical use of the anti-epileptic drugs carbamazepine and phenytoin. Proc Natl Acad Sci U S A. 2005;102(15):5507–12.

    Article  CAS  Google Scholar 

  18. Heinzen EL, Yoon W, Tate SK, Sen A, Wood NW, Sisodiya SM, et al. Nova2 interacts with a cis-acting polymorphism to influence the proportions of drug-responsive splice variants of SCN1A. Am J Hum Genet. 2007;80(5):876–83.

    Article  CAS  Google Scholar 

  19. Fisher RS, Cross JH, French JA, Higurashi N, Hirsch E, Jansen FE, et al. Operational classification of seizure types by the international league against epilepsy: position paper of the ILAE Commission for Classification and Terminology. Epilepsia. 2017;58(4):522–30.

    Article  Google Scholar 

  20. Eltalal S, El Ayouty M, El-Said A, Wahba Y. CYP2C9 (*2&*3) and CYP2C19 (*2&*3) polymorphisms among children with nonlesional epilepsy: a single-center study. Acta Neurol Belg. 2021;121(6):1623–31.

    Article  Google Scholar 

  21. Siddiqui A, Kerb R, Weale ME, Brinkmann U, Smith A, Goldstein DB, et al. Association of multidrug resistance in epilepsy with a polymorphism in the drug-transporter gene ABCB1. N Engl J Med. 2003;348(15):1442–8.

    Article  CAS  Google Scholar 

  22. Kumari R, Lakhan R, Garg R, Kalita J, Misra U, Mittal B. Pharmacogenomic association study on the role of drug metabolizing, drug transporters and drug target gene polymorphisms in drug-resistant epilepsy in a north Indian population. Indian J Hum Genet. 2011;17(Suppl 1):32–40.

    Google Scholar 

  23. Oyrer J, Maljevic S, Scheffer IE, Berkovic SF, Petrou S, Reid CA. Ion channels in genetic epilepsy: from genes and mechanisms to disease-targeted therapies. Pharmacol Rev. 2018;70(1):142–73.

    Article  CAS  Google Scholar 

  24. Elsaid AM, Zahran RF, Elmetwaly SM, Wahba Y, Megahed H, Elshazli RM. The potential impact of CYP2D6 (*2/*4/*10) gene variants among Egyptian epileptic children: a preliminary study. Gene. 2022;832:146585.

    Article  CAS  Google Scholar 

  25. Catterall WA, Goldin AL, Waxman SG. International Union of Pharmacology. XLVII. Nomenclature and structure-function relationships of voltage-gated sodium channels. Pharmacol Rev. 2005;57(4):397–409.

    Article  CAS  Google Scholar 

  26. Oliva M, Berkovic SF, Petrou S. Sodium channels and the neurobiology of epilepsy. Epilepsia. 2012;53(11):1849–59.

    Article  CAS  Google Scholar 

  27. Kang JW, Kim DW, Lee YS, Lee YH, Lee KS. Polymorphism of SCN1A and SCN2A gene in pediatric refractory epilepsy patients. J Korean Epilepsy Soc. 2012;16:49–55.

    Google Scholar 

  28. Escayg A, Heils A, MacDonald BT, Haug K, Sander T, Meisler MH. A novel SCN1A mutation associated with generalized epilepsy with febrile seizures plus—and prevalence of variants in patients with epilepsy. Am J Hum Genet. 2001;68(4):866–73.

    Article  CAS  Google Scholar 

  29. Hosseini M, Ebrahimi A, Houshmand M, Zainali S, Tonekaboni SH, Moghaddasi M. SCN1A and ABCB1 polymorphisms in epilepsy. Arch Neurosci. 2018;5(1):e59383.

    Article  Google Scholar 

  30. Kwan P, Poon WS, Ng HK, Kang DE, Wong V, Ng PW, et al. Multidrug resistance in epilepsy and polymorphisms in the voltage-gated sodium channel genes SCN1A, SCN2A, and SCN3A: correlation among phenotype, genotype, and mRNA expression. Pharmacogenet Genomics. 2008;18(11):989–98.

    Article  CAS  Google Scholar 

  31. Li M, Zhong R, Lu Y, Zhao Q, Li G, Lin W. Association between SCN1A rs2298771, SCN1A rs10188577, SCN2A rs17183814, and SCN2A rs2304016 polymorphisms and responsiveness to antiepileptic drugs: a meta-analysis. Front Neurol. 2020;11:591828.

    Article  Google Scholar 

  32. Tripathi M, Padhy UP, Vibha D, Bhatia R, Padma Srivastava MV, Singh MB, et al. Predictors of refractory epilepsy in North India: a case–control study. Seizure. 2011;20(10):779–83.

    Article  Google Scholar 

  33. Fray S, Kchaou M, Chebbi S, Belal S. Predictors factors of refractory epilepsy in childhood. Rev Neurol (Paris). 2015;171(10):730–5.

    Article  CAS  Google Scholar 

  34. Helbig I, Ellis CA. Personalized medicine in genetic epilepsies–possibilities, challenges, and new frontiers. Neuropharmacology. 2020;172:107970.

    Article  CAS  Google Scholar 

  35. Falsaperla R, Vitaliti G, Mauceri L, Romano C, Pavone P, Motamed-Gorji N, et al. Levetiracetam in neonatal seizures as first-line treatment: a prospective study. J Pediatr Neurosci. 2017;12(1):24–8.

    Article  Google Scholar 

  36. Zhang X, Liu J, Ye J. Association between SCN1A polymorphism and carbamazepine responsiveness in epilepsy: a meta-analysis. Epilepsy Res. 2021;176:106627.

    Article  CAS  Google Scholar 

  37. Zhao GX, Zhang Z, Cai WK, Shen ML, Wang P, He GH. Associations between CYP3A4, CYP3A5 and SCN1A polymorphisms and carbamazepine metabolism in epilepsy: a meta-analysis. Epilepsy Res. 2021;173:106615.

    Article  CAS  Google Scholar 

  38. Shi L, Zhu M, Li H, Wen Z, Chen X, Luo J, et al. SCN1A and SCN2A polymorphisms are associated with response to valproic acid in Chinese epilepsy patients. Eur J Clin Pharmacol. 2019;75(5):655–63.

    Article  CAS  Google Scholar 

Download references

Acknowledgements

We greatly appreciate the role of professor Mostafa El Ayouty, the former head of the pediatric neurology unit of Mansoura University Faculty of Medicine, for his help and support in the access to patients and data.

Funding

Open access funding provided by The Science, Technology & Innovation Funding Authority (STDF) in cooperation with The Egyptian Knowledge Bank (EKB). No funds, grants, or other support was received.

Author information

Authors and Affiliations

  1. Department of Pediatrics, Mansoura University Faculty of Medicine, Mansoura, Egypt

    Esraa Ghazala & Yahya Wahba

  2. Department of Clinical Pathology (Hematology), Mansoura University Faculty of Medicine, Mansoura, Egypt

    Doaa A. Shahin

Authors
  1. Esraa Ghazala
    View author publications

    You can also search for this author in PubMed Google Scholar

  2. Doaa A. Shahin
    View author publications

    You can also search for this author in PubMed Google Scholar

  3. Yahya Wahba
    View author publications

    You can also search for this author in PubMed Google Scholar

Contributions

All authors contributed to the study design and conception. Preparation of materials, data collection and analysis were carried out by EG and YW. The molecular work-up was done by DAS. The first draft of the manuscript was written by YW, and all authors commented on previous versions of the manuscript. All authors read and approved the final manuscript.

Corresponding author

Correspondence to Yahya Wahba.

Ethics declarations

Ethics approval and consent to participate

This study was performed in accordance with the principles of the Declaration of Helsinki, and approved by the Institutional Research Board of Mansoura University Faculty of Medicine, Mansoura, Egypt (Code No: MS.20.02.1041). Written informed consent was obtained from parents and/or legal guardians of the study participants.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no conflict of interest.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.

Reprints and Permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Ghazala, E., Shahin, D.A. & Wahba, Y. Polymorphisms of the sodium voltage-gated channel, alpha subunit 1 (SCN1A -A3184G) gene among children with non-lesional epilepsy: a case-control study. Ital J Pediatr 48, 157 (2022). https://doi.org/10.1186/s13052-022-01350-2

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doi.org/10.1186/s13052-022-01350-2

Keywords

  • Children
  • Epilepsy
  • PCR
  • SCN1A gene

Italian Journal of Pediatrics

ISSN: 1824-7288

Contact us